|
Table Browser User's Guide
|
|
|
|
| |
The Table Browser provides a powerful and flexible graphical
interface for querying and manipulating the Genome Browser
annotation tables. Because the Table Browser uses the same
database as the Genome Browser, the two views are always
consistent.
Using the Table Browser, you can:
-
retrieve the DNA sequence data or annotation data underlying
Genome Browser tracks for the entire genome, a specified
coordinate range, or a set of accessions
-
apply a filter to set constraints on field values included in
the output
-
generate a
custom
track and automatically add it to your session so that it
can be graphically displayed in the Genome Browser
-
conduct both structured and free-from SQL queries on the data
-
combine queries on multiple tables or custom tracks through an
intersection or union and generate a single set of output data
-
display basic statistics calculated over a selected data set
-
display the schema for table and list all other tables in
the database connected to the table
-
organize the output data into several different formats for use
in other applications, spreadsheets, or databases
This User's Guide is aimed at both the novice Table Browser user
as well the advanced user. If you are new to the Table Browser,
read the Getting started section to learn about browser basics
and try some simple queries. Advanced users may want to proceed
directly to the section that addresses a particular
area of functionality in detail.
Although the Table Browser provides sufficient flexibility to
satisfy the needs of most users, some advanced users may require
the ability to run MySQL directly on the Genome Browser database.
UCSC provides a public MySQL server at
genome-mysql.cse.ucsc.edu.
Alternatively, the database may be downloaded to a local computer
for MySQL access. See the
mirror site
documentation for information on setting up a local copy of the
database.
| |
|
|
|
About the Table Browser databases and tables
|
|
| |
The Table Browser is built on top of the Genome Browser
database, which actually consists of several separate
databases, one for each genome assembly.
Tables within the databases may be differentiated by whether the
data are based on genome start-stop coordinates
(positional tables) or are independent of position
(non-positional tables).
Some output formats and query options are applicable only to
positional tables, hence the distinction.
Non-positional tables
Non-positional tables contain data not tied to genomic
location, for example a table that correlates a Known Gene
ID with a RefSeq accession ID. Some non-positional tables relate
internal numeric mRNA IDs to extended information such as author,
tissue, or keyword. Some "meta" tables in this category
contain information about the structure of the database itself
or describe external files containing sequence data.
Positional tables
Positional tables contain data associated with specific
locations in the genome, such as mRNA alignments, gene
predictions, cross-species alignments, and other annotations.
Each of the annotation tracks displayed in the Genome Browser
is based on a positional table. In some instances, data from
other positional and non-positional tables may also be
incorporated into the track. Data associated with custom
annotation tracks active within the user's Table Browser session
are also available as positional tables.
Positional tables can be further subdivided into several
categories based on the type of data they describe. Alignment
data can be best described by using a block structure to represent
each element. Other tables require only start and end
coordinate data for each element. Some tables specify a
translation start and end in addition to the transcription start
and end. Some tables contain strand information, others don't.
Most tables, but not all, specify a name for each element.
Based on the format of the data described by a table, different
query and output formatting options may be offered.
For descriptions of the Genome Browser database tables,
see the annotation
database documentation.
| |
|
|
|
Getting started - simple queries
|
|
| |
In its most basic form, the Table Browser can be used to
retrieve a specific subset of records from a track or positional
table in a selected genome assembly. The query may be based on
a specific position or a set of one or more identifiers.
This section describes the steps required to conduct basic
simple data queries using the Table Browser. Once you have
mastered the basic Table Browser functionality, refer to
subsequent sections for information about generating more
complex queries that use filters, intersections, and alternative
data output formats.
Simple position-based query
Follow these steps to display a list of records that lie
within a specific position in a table:
Step 1. Pick a genome assembly
Specify the genome assembly from which you'd like to retrieve the
data by choosing the appropriate organism in the genome
list, then selecting the assembly version from the
assembly list. Note that the assembly list
refreshes each time a different option is selected in the
genome list.
Step 2. Pick an annotation track
The group list shows all the annotation track groups
available in the selected genome assembly. The names correspond
to the groupings displayed at the bottom of the Genome Browser
annotation tracks page. When a group is selected from the list,
the track list automatically updates to show all the
annotation tracks available within that group.
-
If you already know the name of the annotation track in which
you're interested, select the All Tracks option in the
group list, then select the track from the
track list.
Similarly, you can directly select a table by
choosing the All Tables option in the
group list, selecting a database from the
database list, then selecting the table from
the table list.
-
To examine all the tracks available within a certain group (e.g.
all gene prediction tracks), select the group name from the
group list, then browse the entries in the
track list.
-
Custom annotation tracks created during the current session
are listed under the Custom Tracks group.
-
If no selections are made from the group or
track lists, the track selection defaults to the
Known Genes track in the Genes and Gene Prediction Tracks group.
Step 3. Pick a table
The table list shows all tables (both positional
and non-positional) associated
with the currently-selected track. By default, it
displays the primary table for the track, i.e. the table
containing the data shown in the Genome Browser
annotation track. Other tables in the list are linked to the
primary table by a common field and may provide supporting
data used in constructing the annotation.
-
If the group list is set to the
All Tables option, the tables list will show all tables
present in the database currently selected in the
database list, rather than those associated with
a particular track.
Step 4. Pick a genomic region (positional tables only)
By default, the Table Browser region is set to genome,
which will display all the data records in the selected table.
-
To restrict the data to a specific position
range, type the position into the position box. Some
examples of specific positions include a chromosome name
(chrX), a coordinate range within a chromosome
(chrX:100000-400000), or a scaffold name.
-
To view data only in those regions covered by the ENCODE
project, click the button preceding the ENCODE option.
-
To look up the position range of a genomic element -- such
as a gene name, an accession ID, an STS marker, etc. -- or
keywords from the GenBank description of an mRNA,
type the string into the position box, then
click the Lookup button.
-
The data in non-positional tables are not tied to genomic
coordinates; therefore, the region option is
unavailable when a non-positional table is selected. A basic
query on a non-positional table will show all the data in the
table.
Step 5. Display the output
Click the Get Output button to display the
results of the query. By default, the Table Browser outputs the
data from all fields in the selected table as tab-separated text
on the screen. See the Output Formats
section for information on configuring the query output.
Example:
Here is an example of a simple query that retrieves all the
RefSeq Genes records in the position range
chr7:26906938-26940301 on the May 2004 human genome assembly.
-
Select the Human option in the genome list
-
Select the May 2004 option in the assembly list
-
Select the Genes and Gene Prediction Tracks option in the
group list.
-
Select the RefSeq Genes option in the
track list.
-
Type chr7:26906938-26940301 in the
position box (the Table Browser will
automatically select the position option button).
-
Click the Get Output button.
The Table Browser will display the records for the RefSeq
accessions NM_005522, NM_153620, NM_006735, NM_153632, NM_030661,
and NM_153631.
Batch query using identifiers
In many cases, you may want to retrieve data based on a list of
one or more accessions or names, rather than querying by
genomic position. Many tracks in the Table Browser, such as
those in the Genes and Gene Prediction track group,
support identifier queries. The identifier type used in the
query must match the kind of identifiers present in the track data, e.g.
mRNA accession IDs must be used to query the mRNA table.
Follow these steps to display a list of
records that correspond to a set of accessions or names entered
as query input.
Step 1. Pick the genome assembly, track, and table
Step 2. Select the genome region setting
Step 3. Load the identifiers into the browser
Click the Paste List
button to type or paste in the identifiers or the
Upload List button to load the data from a
file existing on your local computer.
- If you are loading
multiple identifiers, entries must be separated by a space, tab,
or line.
- Wildcards may not be used in the list (see the
Filter section for information about
conducting queries that include wildcards).
- The Table Browser
will retain the identifier list until you delete the
information by clicking the Clear List button.
Step 4. Click the Get Output button
See the Output Formats
section for information about configuring the query output.
| |
|
|
|
Filtering output by constraining field values
|
|
| |
The Table Browser filter option can be used to:
-
apply constraints on table field values to restrict which records
should appear in the query output
-
conduct batch queries using wildcards
-
include fields from multiple tables in the query output
Filtering on fields from a single table
Follow these steps to create a filter on one or more fields in a
single table:
Step 1. Select the assembly, track, and region
Step 2. Click the Create button on the
filter line
Step 3. Add the filter constraints
One or more of the fields in the currently selected table may
be filtered by typing constraints into the corresponding text
boxes.
- By default, the initial values set up in the filter match all
records in the table.
- Constraints must match the data type of the field to be applied
successfully. For example, the geneName field in the hg17
refFlat table is a string; therefore, constraining values
must also be strings. See the Filter
constraints sections for more information on valid filter
values.
- Multiple filter values may be applied against one field by
separating the values with spaces.
- Individual field constraints are combined with AND,
i.e. a record must meet the constraints on all fields to be
retrieved.
Step 4. Click the Submit button to apply the filter
Once a filter has been created on a table, it will persist for the
duration of the Table Browser session or until it has been
cleared. Only one filter can exist for a table at a time, but multiple filters may exist in one session if they are applied on different tables.
To modify an existing filter, click the Edit
button on the filter line. To remove a filter,
click the Clear button.
Filtering on fields from multiple
tables
A Table Browser filter may include constraints on fields from
tables related to the primary table. To create a filter composed
of fields from multiple tables:
Step 1. Select the assembly, track, and region
Step 2. Click the Create button on the
filter line
Note: If a filter already exists on the table,
click the Edit
button to modify it or the Clear button to
remove it.
Step 3. Select the tables to include in the filter
Scroll down to the Linked Tables
section of the page. The tables listed in this section are
linked to the selected table by one or more common fields (typically
a name, accession, or ID field). Click the boxes in front of the
table(s) whose fields you wish to include in the filter,
then click the Allow Filtering Using Field in Checked
Tables button.
The fields of the selected tables will be displayed in the top
portion of the page.
Step 4. Add the filter constraints
Step 5. Click the Submit button to apply the filter
Note: In the current implementation of the Table Browser,
the selected fields from primary and related tables output
format option must be used when including fields from multiple
tables in a filter. Check the boxes for all tables in the
Linked Tables list on which filter constraints
have been applied, then click the Allow Selection From
Checked Tables button to include them in the output.
Filter constraints
Strings
Text fields are compared to words or patterns containing wildcard
characters. Valid wildcards are "*" (matches 0 or more characters)
and "?" (matches a single character). Each space-separated
word or pattern in a text field box is matched against the
value of that field in each record. If any word or pattern matches
the value, then the record meets the constraint on that field.
Numbers
Numeric fields are compared to table data using an operator such
as <, >, != (not equals) followed by a number. To specify a range,
enter two numbers (start and end) separated by white space and/or
a comma.
Free-form queries
When the filters on individual fields aren't sufficiently flexible,
the free-form query text box allows the application
of more complex constraints that typically relate two or more
field names of the selected table. Valid free-form queries use
the syntax of the SQL
where clause (using
wildcards as defined above).
Free-form queries combine simple
constraints with AND, OR, and NOT
using parentheses as needed for clarity. A simple constraint
consists of a table field name, a comparison operator (see below), and a value: a number, string, wildcard value (see below), or
another field name. In place of a field name, you may use an
arithmetic expression of numeric field names.
-
String or wildcard values for text comparisons must be quoted.
Single or double quotes may be used. If comparing to a literal
string value, use the "=" or "!=" operator. If comparing
to a wildcard value, use the "LIKE" or "NOT LIKE"
operator.
-
Numeric comparison operators include <, <=, =, != (not equals),
>=, and >.
- Arithmetic operators include +, -, *, and /.
- Other SQL comparison keywords may also be used.
Example:
The following examples show free-form queries applied to the
human refGene table).
-
txStart = cdsStart -
searches for gene models
missing expected 5' UTR upstream sequence (if strand is '+'; 3' UTR
downstream if strand is '-')
-
chrom NOT LIKE "chr??"
- restricts search to chromosomes 1 - 9, X and Y
-
cdsEnd - cdsStart) > 10000
- selects genes with coding spanning more than 10 kbp
-
txStart != cdsStart) AND
(txEnd != cdsEnd) AND exonCount = 1 -
finds single exon genes with both 3' and 5' flanking UTR.
-
cdsEnd - cdsStart) > 30000) AND
(exonCount=2 OR exonCount=3) - finds genes with
long spans but only 2 - 3 exons
| |
|
|
|
Intersecting data from multiple tables
|
|
| |
It is often interesting to compare the positions of features
in different annotation tracks to identify points of overlap. The
Table Browser intersection
utility can be used to generate various position-based
comparisons of track features. Using the
intersection utility, you can:
-
examine all genomic positions where the feature data from the two
tracks overlap
-
identify genomic locations where there is no overlap between
track features
-
establish thresholds for the amount of overlap that must exist
between the two feature sets
-
conduct feature-by-feature comparisons as well as
base-by-base comparisons of tracks
-
complement (invert) a position set before comparing the tracks
An
intersection may be expanded to include additional tables by using
the Table Browser custom track feature.
Note: The intersection utility can be used
only on positional tables. To
generate intersections incorporating data in non-positional tables,
use the Table Browser filter utility. See the
Filtering on fields from multiple
tables section for more information.
Intersecting data from two tables
Follow these steps to configure and generate an intersection between
two positional tables:
Step 1. Select the assembly, track, table, and region for the
primary table
Note: Only positional tables may be used in an intersection.
Step 2. Click the Create button on the
intersection line
Note: If an intersection already exists on the table,
click the Edit
button to modify it or the Clear button to
remove it.
Step 3. Select the secondary track to include in the filter
Select a group in the group list, then select a
track from the track list. To view all the
tracks available, regardless of group, select the
All Tracks option in the group list.
Step 4. Select a combination method
The Table Browser provides two major types of comparisons:
-
feature-by-feature comparisons preserve the structure of
the primary table. For example, if the primary
table describes exon structure and the features are compared
with a second table, the results will describe exon structure
(unless you choose an output format in which the structure is
lost).
-
base-by-base comparisons examine
the primary table and the table underlying the secondary track one
base at a time. The structure
of the primary table is not preserved in this comparison. For
example, even if the primary table describes
exon structure, the intersection results will contain only position
ranges; no information about exon/block structure, strand, or
translation region will be retained.
Click the circle in front of a combination method to select it.
Only one method may be selected from the two sets of methods. For
more information about the individual combination options, see the
Intersection Options section.
Step 5. (optional) Select the complement options
Check the box in front of one or both tables to complement the
feature data in the The complement options allow you to invert the
set of positions
covered by one or both tables. For example, if you choose to
complement the primary track, any position covered by the that
track's features will be considered not covered, and vice
versa. This option provides more flexibility in comparing track
positions.
Step 6. Click the Submit button to apply the
intersection
Once an intersection has been created on a table, it will persist
for the duration of the Table Browser session or until it has been
cleared. Only one intersection may exist at a time.
To modify an existing intersection, click the Edit
button on the intersection line. To remove an
intersection, click the Clear button.
Intersecting data from more than two tables
The Table Browser intersection utility limits
combinations to only two tables. An existing intersection may be
expanded to include additional tables by using the Table Browser
custom track utility. To create an intersection on multiple tables:
Step 1. Set up an intersection between two tables
See the Intersecting data
from two tables section for more information.
Step 2. Save the intersection data in a custom track
See the Saving data as a custom track
section for information on generating a custom track.
Note: In the
current implementation of the Table Browser, you must use the
Get Custom Track button on the custom track page
to add the custom track to the Table Browser track
list.
Step 3. Select the newly-generated custom track
Select the Custom Tracks option in the
group list, then select the newly-created custom
track from the track list.
Step 4. Create an intersection with another track
Follow the steps in the
Intersecting data from two tables
section to intersect the custom track with another track.
Intersection options
Feature-by-feature comparisons
Some comparisons preserve the primary table's gene and alignment
structure, if it exists. For example, if the refGene
table (human RefSeq Genes track) is combined with another
table using one of these comparisons, the resulting output data
will describe exon structure (unless you choose an output format
in which the structure is lost). Primary table features are kept
or discarded based on the amount of positional overlap with
the features in the table underlying the secondary track. The
Table Browser offers the following options in this category:
-
Any overlap: A primary table record will appear in the
output if any of its base positions are covered by any
feature in the secondary table.
-
No overlap: A primary table record will appear in the
output only if none of its base positions are covered by any
feature in the secondary table.
-
Overlap greater than a specified threshold: A primary table
record will appear in the output if the percentage of its
base positions covered by secondary table features is greater than
the user-specified threshold.
-
Overlap less a specified threshold: A primary table record
will appear in the output if the percentage of its base positions
covered by secondary table features is less than the user-specified
threshold.
Note: If the primary table has an exon/block structure,
only those bases located in exons and/or blocks will be counted.
Base-by-base comparisons
In these combination options, the positions of the primary
and secondary table features are compared one base position at a
time. When applying base-by-base comparisons, the structure of the
primary table is not preserved. For example, if the refGene
table (from the human RefSeq Genes track) is compared with
a secondary table using these comparisons, the resulting output
data will not describe exon structure. Instead, only position
ranges will be returned; the exon/block structure, strand, and
translation region information will be discarded. The Table Browser
provides the following base-by-base combination options:
-
Base-by-base intersection (AND): A nucleotide position
is included in the output if it is covered by at least one feature
of both the primary table and the secondary table.
-
Base-by-base union (OR): A nucleotide position is
included in the output if it is covered by at least one feature of
either the primary table or the secondary table.
Note: If the primary table has an exon/block structure,
only base positions located in exons and/or blocks will be counted.
Base-by-base complement (NOT)
Before the Table Browser applies a feature-by-feature or
base-by-base comparison to the table data, the set of positions
covered by one or both tables can be inverted (complemented). When
the data set of a table is complemented, any position
covered by the table's features in the original data will be
considered not covered in the inverted data, and vice versa.
This option gives the user more flexibility in comparing table
positions.
| |
|
|
|
| |
The data resulting from a Table Browser query may be configured in
a number of different ways:
-
The output can be displayed on the
screen, saved to a file, or saved to an annotation track table
that can be displayed in the Genome Browser or used in a subsequent
Table Browser query.
-
The data can include all fields from the primary or selected table,
or can be restricted to selected fields from the
primary table and related tables.
-
The data can be organized in one of several formats: tab-separated,
sequence (FASTA), Browser Extensible Data format (BED),
Gene Transfer Format (GTF), or a statistical summary of the data
in the query.
The output options available for a specific query may vary
depending on the table(s) selected. For example, non-positional
table data cannot be organized in a position-based format, but
instead may be displayed only in tab-separated format. The Table
Browser will automatically update the options on the
output format list to show only those available
for the current query.
Displaying all fields in a table
To display all the fields of the records in the query output
in tab-separated format, select the all fields from primary
table option.
Displaying selected fields from one or more tables
To restrict the query output to a subset of the fields in a table,
choose
the selected fields from primary and related tables option.
You will be prompted to pick the table fields to display. Click the
box in front of the fields you would like to see in the query
output (or
click the Check All button to select all the
fields), then click the Get Fields button.
To include data fields from other tables linked to the selected
table, choose the selected fields from primary and related
tables option, then scroll down to the Linked Tables
section of the page. The tables listed in this section are
linked to the selected table by one or more common fields (typically
a name, accession, or ID field). Click the boxes in front of the
table(s) whose fields you wish to include in the query output,
then click the Allow Selection From Checked Tables.
The fields of the selected tables will be displayed in the top
portion of the page. Click the boxes in front of the fields
that you wish to include in the query output, then click the
Get Fields button underneath any of the field
lists to generate tab-separated output that includes data from
all the selected fields. Note that the Get Fields
and Cancel buttons apply globally to all the
selected tables, but the Check All and
Clear All buttons apply only to the fields listed
directly above the buttons.
Displaying sequence (FASTA) data (positional tables only)
To display the genomic sequence underlying the query results,
select the sequence option in the output
format list. The Table Browser will present you with
several options to configure the output display. When you have
completed the configuration, click the Get Sequence
button.
When displaying sequence data for tracks in the Genes and
Gene Predictions group, you will be offered the option to
view the protein sequence associated with the track rather than
the genomic sequence.
Displaying CDS FASTA alignments (genePred tables only)
The CDS FASTA alignments are created from a Multiple Alignment File
(MAF) in
combination with a
genePred table.
The UCSC MAF format stores
multiple alignments at the DNA level between entire genomes. You can
use the Table Browser to return FASTA alignments of coding regions in
nucleotide-space or translated into
amino acid-space. However, it is worth noting that the initial
MAF files are all created by aligning genomes at the DNA level.
Genome-wide CDS FASTA alignments
Note that when using
the Table Browser to fetch CDS FASTA output, it is best to
restrict your query to a reasonable-sized position range rather than
requesting output from the entire genome. A genome-wide
query will take a substantial amount of compute time, and it is
likely that your Internet browser will time out and disconnect.
If you would like to download genome-wide CDS FASTA output
for any of several model organisms, you can do so from the
download server.
Creating CDS FASTA alignments using the Table Browser
To display FASTA multiple alignments for the CDS regions of genes,
select the CDS FASTA alignment from multiple alignment
option in the output format list. In order to see
this output format option, you must have a genePred table
selected.
If you limit your search to a certain position range within the
genome (rather than searching the entire genome), the tool
will return FASTA alignments for all genes that overlap
the position for which you are searching.
The Table Browser will present you with a configuration page.
On this page, you can select options for your ouput.
First, select your MAF table. This is the table from which
the multiple alignments will be extracted for the CDS regions
of your gene track. If you do not know the name of the MAF table
that corresponds to the Conservation track, you can find it in the
Genome Browser by following these
instructions.
Then select any of the following choices:
- Separate into exons -
The default behavior is for the coding exons of each gene to be
concatenated into
one sequence in the output FASTA multiple alignment. In this
case each output row header has the format listed
below under "Whole gene format".
If the separate into exons option is chosen then each exon will be
listed with a separate header in the format
listed below under "Exon format".
- Show nucleotides -
The default behavior is for the nucleotides in the alignment
to be translated
into amino acids according to the strand and exon frames
defined in the selected genePred table.
If this option is chosen, then the nucleotides
in the alignment will not be translated into amino
acids.
- Output lines with just dashes -
The default behavior is for the alignment rows that contain
only dashes to not be printed. If this option is chosen, then
these dashes-only rows are printed.
Finally, from the list of species, select those that you would
like included in the FASTA multiple alignment output. Press
the "get output" button to view the output.
Explanation of CDS FASTA header format
— Whole gene format:
geneName_assemblyName peptideLength location
— Exon format:
geneName_assemblyName_exonNum_totalExons exonLength inFrame
outFrame location
Following are the descriptions for each field name:
- geneName- the name field from the genePred table.
- assemblyName- the UCSC assembly
name
for the species.
- peptideLength- the length of the entire coding region.
If the "Show nucleotides" option is chosen, this will
be in nucleotides, otherwise it will be the number of amino
acids in the peptide.
- location- this is the chromosome position within the
assembly that is aligned in the multiple alignment. The format
of this string is chrom:start-end followed by the strand
where the alignment occurs. If more than one region is
aligned then all the regions are listed with a semi-colon (;)
between each position. This address is in genome browser
coordinates (i.e. the start address is
one-based).
- exonNum- the ordinal of the exon. Exons are
counted starting at one and begin at the transcription start site
and progress along the strand of transcription.
- totalExons- the number of coding exons in the gene.
- exonLength- the length of the current exon.
If the "Show nucleotides" option is chosen, this will
be the
number of nucleotides in the exon, otherwise it will be
the number of amino acids in
the exon (with amino acids translated from split codons
placed in the exon where two of the three nucleotides lie).
- inFrame- the frame number of the first nucleotide
in the exon. Frame numbers can be 0, 1, or 2 depending on
what position that nucleotide takes in the codon which
contains it.
- outFrame- the frame number of the nucleotide
after the last nucleotide in this exon.
Frame numbers can be 0, 1, or 2 depending on
what position that nucleotide takes in the codon which
contains it.
Explanation of CDS FASTA sequence format
As noted above, the CDS FASTA output files can be in either DNA-space
or protein-space.
In some instances, there is a dash ("–") in the
sequence portion of the CDS FASTA file. Dashes are used in several
circumstances. They indicate missing sequence for the aligning
genome, as well as deletions in the aligning genome or insertions
in the base genome.
Because the CDS FASTA alignments are based on one reference
genome, any amino acids or nucleotides that are not
in the reference genome are not displayed. Consequently the peptides
shown for aligning genomes are not necessarily the peptide that
the other organisms' gene would generate. Any sequence inserted
in an aligning genome or deleted in the base genome will not be
present in the alignment. We represent this condition
with an orange bar in the Genome Browser display, but
the CDS FASTA alignments silently ignore this issue.
— Nucleotide CDS FASTA sequence:
Consider the example below that shows the FASTA sequence for four
species aligned with the first exon of the human gene
PLEKHO1 (UCSC Gene: uc001ett.1). Note that the rat (rn4) row
is missing
the first three nucleotides. This could be due to a
lineage-specific insertion between the rat and
human genomes, or a lineage-specific deletion between the
human and rat genomes. Note also that the Zebrafish
(danRer4) row contains only dashes. This could be due to
excessive evolutionary distance between the zebrafish and human,
missing data in the zebrafish, or independent indels in the region in
both species. Sometimes it is helpful to view the
Conservation track in the Genome Browser in this area to
clarify the exact meaning of the dashes.
>uc001ett.1_hg18_1_6 30 0 0 chr1:148389072-148389101+
ATGATGAAGAAGAACAATTCCGCCAAGCGG
>uc001ett.1_panTro2_1_6 30 0 0 chr1:129156502-129156531+
ATGATGAAGAAGAACAATTCCGCCAAGCGG
>uc001ett.1_rn4_1_6 30 0 0 chr2:190795892-190795918-
---ATGAAGAAGAGCGGCTCCGGCAAGCGG
>uc001ett.1_danRer4_1_6 30 0 0
------------------------------
>uc001ett.1_oryLat1_1_6 30 0 0 chr11:3404940-3404969-
AGGATGAAGAAAAGCAACCAGAGCAGGCGG
— Amino Acid CDS FASTA sequence:
- Codons that have a dash in any of the three nucleotides are
represented by a dash in the amino acid.
- Codons with an N in any position are represented with an X.
- Stop codons are represented with a Z.
- All other amino acids follow the IUPAC amino acid codes.
- In exon format, when the codon triplet is split between two
exons, the amino acid will be displayed as part of the exon
containing two of the three nucleotides like so:
|exon1| |exon2|
nucleotide: AAACCCT TTGGGAAA
protein: K P F G K
Saving query results in GTF or BED format (positional tables only)
To format the query results using
GTF or
BED conventions,
select the corresponding option in the output
format list. Note that when you select GTF, the table browser
translates the output into this format. For tables that lack feature
designations, all records are arbitrarily assigned the feature "exon" to
conform to GTF specifications.
If you select BED format, you will be
presented with the option to include and configure a custom track
header and options for organizing the data. When you have finished
the configuration -- or to accept the default options -- click
the Get BED button at the bottom of the window.
Saving data to a file
By default, the Table Browser displays query results directly in
your internet browser window. To redirect the data to a file,
type a file name into the output file box before
starting the query. The Table Browser will prompt you for the
location of this file on your local disk while processing the
query.
Saving data as a custom track (positional tables only)
Query output may be saved in a format that can be displayed as
a custom annotation track in the Genome Browser. Custom tracks
created during a Table Browser session may also be used for
subsequent queries and intersections in the same session. For
more information on custom tracks, see the Genome Browser
User's Guide.
To save query data in custom track format, select the custom
track option in the output format list. When
the query is executed, the Table Browser will prompt you to
customize the track header and configure the record layout of
the data. The configuration is optional; the Table Browser
automatically sets up a default track configuration. Click the
Custom track link for more information on custom track
syntax and format.
When you have finished configuring the custom track -- or to accept
the default configuration -- click one of the buttons at the bottom
of the window to create the custom annotation track.
-
To display the query results as text on the screen, click the
Get Custom Track File button.
-
To save the query results to a file on your local disk for future
use, specify a file name in the output file box
before executing the query, then click the Get Custom Track
File button.
-
To load the query results into a table accessible from the
Table Browser table list, click the
Get Custom Track in Table Browser button.
-
To view the query results as a custom track in the Genome
Browser, click the Get Custom Track in Genome
Browser button. Your
browser display will be redirected automatically to the Genome
Browser, with your custom track positioned near the top of the
annotation tracks window.
-
To access your custom track data in a subsequent query in the same
Table Browser session, select the Custom Tracks option
from the group list to display the custom tracks
available.
Displaying query results as Genome Browser hyperlinks (positional tables only)
To examine the records in the query output individually in the
Genome Browser, select the hyperlinks to Genome Browser
output option. The Table Browser will display a list of one or
more hyperlinks corresponding to the individual records in the
output data. Click a link to open up the Genome Browser display
to the item and position shown on the hyperlink.
Displaying a statistical summary
of query data (positional tables only)
To generate a statistical summary of the query output data, the
region covered by the query, and the CPU time required to process
the query, click the Summary/Statistics button.
| |
|
|
|